Nucleic Acids: Innovative Methods for Recovery, Clarification and Purification

Sammanfattning: Popular Abstract in English ...GTAAAAATTAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGAT TATGCCTGGCACCATTAAAGAAAATATCTTTGGTGTTTCCTATGATGAATATAGATACA GAAGCGTCATCAAAGCATGCCAACTAGAAGAG1.... The string of these block letters (A, T, C and G) is a tiny part of the human DNA sequence, which is more than 3 billion letters long. The combination of these block letters carries genetic information, similar to how the combination of letters form words. Genes, long DNA molecules, are how living organisms receive features from their ancestors. The sequence of DNA molecules of many different organisms is now known, including the human genome completed in 2003. The studies of the human genome are revealing disease origins and other biochemical mysteries. As a consequence of this, scientists came closer to new and better means of diagnosing and treating genetic disorders. The genetic disorders are diseases caused by one or more abnormalities in the genes, from hereditary origin and/or caused by the environment. The appearance of gene therapy, i.e. the insertion in the cells of the new genes missing, or by the expression of a precise gene sequence that produces a specific protein missing, opened new perspectives of treatments. The common process for the production of these therapeutic genes is bacteria-based. Therefore, efficient methods for recovery and purification of these products are needed in order to fulfill basic patterns for being acceptable for gene therapy use. Starting with electropermeability extraction of nucleic acids as a recovery approach, by clarification with aqueous two-phase systems and multimodal chromatographic methods for DNA purification were the aims of this thesis.